rs7214719 chr17:27256425 A>G
- Sequence
ttctggaggtcaaggagttccatt[A/G]ttggttcatttcccagaacaattt
- ASB in cell types
- upper lobe of left lung TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- EP300_HUMAN SMRC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | 2.69 | 0.22 | 2.75 | n/a | n/a | |||
| SMRC1_HUMAN | -0.57 | 1.66 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), hdl cholesterol, height, infant head circumference, ldl cholesterol, microalbuminuria, total cholesterol, urinary albumin-to-creatinine ratio