rs7217098 chr17:6666211 A>G
- Sequence
gagggcagacaatccccgcacagc[A/G]gcaaaggctggacttcggaggagt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) CD14+ monocytes D54 (H54, Human glioblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.39 | 0.74 | 1.16 | |||
| CD14+ monocytes | 2.56 | n/a | 3.00 | |||
| D54 (H54, Human glioblastoma) | -3.55 | 1.77 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Brain_Caudate_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Lung, Nerve_Tibial, Ovary, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Uterus, Whole_Blood