rs7217756 chr17:51435645 G>A
- Sequence
ctgcgatgtgtcctggatgcaaag[G/A]ccacctcctggagtttttgctacc
- ASB in cell types
- PANC1 (pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PANC1 (pancreatic ductal adenocarcinoma) | -2.50 | 1.75 | 1.50 |
Items per page:
1 – 1 of 1