rs7226559 chr18:2641049 G>A
- Sequence
gaatctctttcctcttctaaatgc[G/A]gaagtctcctgaggatctctgtgg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MDM(monocyte derived macrophages) CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- ELF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF1_HUMAN | 2.33 | -2.17 | 1.00 | -5.57 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
