rs7230700 chr18:48024009 A>G
- Sequence
gccattgaatcacgttcacatttg[A/G]tgactcctttcagggcaggtttgg
- ASB in cell types
- MS-1 (Small cell lung carcinoma) erythroid cells GM12890 (Lymphoblastoid Cell Lines) HMEC (human mammary epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | -1.01 | 1.09 | 1.00 | |||
| erythroid cells | 2.79 | n/a | 2.00 | |||
| GM12890 (Lymphoblastoid Cell Lines) | 1.51 | -1.07 | 1.00 | |||
| HMEC (human mammary epithelial cells) | 1.22 | -0.14 | 1.00 |
Items per page:
1 – 4 of 4