rs7237888 chr18:72542086 C>A
- Sequence
ccccaggcaggatccgcagccgcc[C/A]ggctcgcgcagcgccccccggcgc
- ASB in cell types
- GM23338 KMS-11 (Plasma cell myeloma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.26 | 1.83 | 1.47 | n/a | No Hit |
Items per page:
1 – 1 of 1