rs7246721 chr19:9914754 A>G
- Sequence
gcccacgcatcagccggcggcggc[A/G]gccgctgggccgcggagaggagcg
- ASB in cell types
- K562 (myelogenous leukemia) LUHMES (lund human mesencephalic cells) GM18951 (B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.20 | 0.91 | 2.00 | |||
| LUHMES (lund human mesencephalic cells) | 2.22 | -0.77 | 1.00 | |||
| GM18951 (B-cells Lymphoblastoid Cell Lines) | 1.38 | -0.97 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis