rs72479351 chr10:132352769 A>G
- Sequence
gcagccccgaggcctccctgtggg[A/G]caggccggttgcagtgctcgcggt
- ASB in cell types
- MDM(monocyte derived macrophages) KB (cervical adenocarcinoma) SH-SY5Y (neuroblastoma) sigmoid colon
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | 1.85 | -0.10 | 1.60 | |||
| KB (cervical adenocarcinoma) | n/a | 3.06 | 2.00 | |||
| SH-SY5Y (neuroblastoma) | 1.72 | -1.54 | 1.00 | |||
| sigmoid colon | 1.52 | -0.24 | 1.00 | |||
| neural cell | 0.86 | -0.15 | 1.00 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood