rs7248836 chr19:11659120 T>C
- Sequence
gagctttgcttgaatgagcttgac[T/C]acaatgcgaatgctgaggcttatt
- ASB in cell types
- primary breast cancer
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary breast cancer | -2.21 | 3.00 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy)
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Left_Ventricle, Nerve_Tibial, Pancreas, Spleen, Testis, Thyroid, Whole_Blood