rs72509 chr13:110250840 G>T
- Sequence
tccccagcatccgggtcccacgga[G/T]cccctcccaaaccaagtgtcagct
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -1.29 | 2.49 | 2.00 | n/a | No Hit | |||
| EP300_HUMAN | 1.36 | -0.18 | 1.21 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, hip bone mineral density (bmd), ldl cholesterol, salmonella-induced pyroptosis