rs7251067 chr19:18489246 G>A
- Sequence
tctaggtcagaacatggtgcaggt[G/A]tgagcgagggggcgtcctcccagg
- ASB in cell types
- BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 0.10 | 1.53 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP anti-cytomegalovirus igg titer, autism with high iq, college completion, fasting insulin, hdl cholesterol, height, late onset alzheimers disease, triglycerides change with statins, years of education
GTEx eQTL Adipose_Subcutaneous, Colon_Transverse, Esophagus_Mucosa, Liver, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood