rs7251708 chr19:47186440 G>A
- Sequence
atttataggtaattcattcagcgg[G/A]taagggtcaggaccttttataggg
- ASB in cell types
- germinal center B-cells MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| germinal center B-cells | 1.71 | -0.59 | 2.00 | |||
| MS-1 (Small cell lung carcinoma) | -1.85 | 2.15 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic