rs7255188 chr19:49916899 C>T
- Sequence
catgccaccatacttcagcctggg[C/T]ggctgagcgagaccccgtctcaaa
- ASB in cell types
- ID00014 (lymphoblastoid cell, DiGeorge syndrome)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 3.77 | n/a | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Coronary, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood