rs7256867 chr19:47509521 G>A
- Sequence
atcttgcaggcagcaccccacggc[G/A]tgcccagcagagagctggccacac
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 3.30 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, diastolic blood pressure (dbp), hdl cholesterol, systolic blood pressure (sbp), total cholesterol, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood