rs7257434 chr19:55504081 C>T
- Sequence
ccgtgacttgggggtgggtgggct[C/T]cagctgtgagttagagctatcatt
- ASB in cell types
- K562 (myelogenous leukemia) Kelly (neuroblastoma) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.15 | 1.02 | 1.99 | |||
| Kelly (neuroblastoma) | 2.27 | -1.79 | 1.00 | |||
| HepG2 (hepatoblastoma) | 0.36 | 0.82 | 1.12 |
Items per page:
1 – 3 of 3