rs7257763 chr19:6761166 C>T
- Sequence
tgtccccctttctcctggcaccta[C/T]gtagactacatttcccaggttccc
- ASB in cell types
- CUTLL1 (T-cell lymphoblastic lymphoma 1)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CUTLL1 (T-cell lymphoblastic lymphoma 1) | 2.65 | -4.88 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Esophagus_Mucosa, Lung, Minor_Salivary_Gland, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid