rs7259038 chr19:2637233 C>G
- Sequence
ggctccccccgcccccgagcccgg[C/G]ccgtctttgctgttgtcgttgttg
- ASB in cell types
- MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line) T cells from peripheral blood HMEC (human mammary epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line) | 1.54 | -0.60 | 1.00 | |||
| T cells from peripheral blood | 2.11 | -1.76 | 1.00 | |||
| HMEC (human mammary epithelial cells) | 1.09 | -0.56 | 1.00 |
Items per page:
1 – 3 of 3