rs7262497 chr20:62496699 C>T
- Sequence
gccgggcgttcgggacccagacag[C/T]gccagggctttaggagcccccctc
- ASB in cell types
- foreskin keratinocyte NB69 (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.84 | -2.27 | 2.50 | |||
| NB69 (neuroblastoma) | -3.65 | 2.03 | 1.50 |
Items per page:
1 – 2 of 2