rs72630 chr6:16316831 G>C
- Sequence
tggaaaaacattgcaatggtacaa[G/C]tggacaacagggggcaatagagag
- ASB in cell types
- K562 (myelogenous leukemia) GM19240 (B cells Lymphoblastoid Cell Lines) WA09 (embryonic stem cells) Kelly (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.41 | 1.02 | 2.93 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | 1.12 | -1.27 | 1.00 | |||
| WA09 (embryonic stem cells) | 1.94 | -0.18 | 1.30 | |||
| Kelly (neuroblastoma) | 1.51 | 0.88 | 1.00 |
Items per page:
1 – 4 of 4