rs72635708 chr1:8197900 T>C
- Sequence
ccaggatggccgagtgctgagtca[T/C]gcacccctcttcacccgaagctcc
- ASB in cell types
- HEK293 (embryonic kidney) HKC8 (kidney proximal tubule cell line) endometrial stromal cells TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- E2F8_HUMAN EPAS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| E2F8_HUMAN | -0.38 | 1.50 | 1.00 | n/a | n/a | |||
| EPAS1_HUMAN | 0.03 | 1.22 | 1.00 | 6.01 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
