rs72638543 chr1:6935462 C>T
- Sequence
ccacatctctgtctgctccagtcg[C/T]ggggctgcagctgttggcacacac
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) HDF(human dermal fibroblasts)
- ASB for transcription factors
- EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | 1.61 | -0.32 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1