rs72639129 chr11:76209133 G>A
- Sequence
tctataggacacttgccgtgggcc[G/A]ccctgacctgcccggccccttgct
- ASB in cell types
- MS-1 (Small cell lung carcinoma) HEK293 (embryonic kidney) KMS-11 (Plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | 0.75 | -0.39 | 1.00 | |||
| HEK293 (embryonic kidney) | 0.76 | 0.74 | 1.07 | |||
| KMS-11 (Plasma cell myeloma) | 1.68 | -0.33 | 2.33 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Muscle_Skeletal, Pancreas, Whole_Blood