rs72664136 chr1:54070246 G>A
- Sequence
gtctttataggttataatcactag[G/A]gggcaataagaccattcatatgag
- ASB in cell types
- GM10847 (female B-cells Lymphoblastoid Cell Lines) neural progenitors HUES64 (embryonic stem cells) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.15 | 0.48 | 1.20 | -0.56 | Weak Concordant | |||
| STAG1_HUMAN | 0.59 | -0.06 | 1.11 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
