rs72686286 chr14:23589173 G>T
- Sequence
ctcccggcagccaccaggggtcag[G/T]atggggccagagatgctgctggtg
- ASB in cell types
- HCT-116-RAD21-mAC GM12892 (female B-cells lymphoblastoid cell line) CD14+ monocytes
- ASB for transcription factors
- CTCF_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.25 | 1.09 | 1.19 | 1.81 | Weak Concordant | |||
| STAT1_HUMAN | 1.84 | -0.21 | 3.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
