rs72686446 chr1:45300507 C>T
- Sequence
cacccacttggcccgtaagtggtt[C/T]gttcatacatttattgtggttcat
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | -0.53 | 0.52 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Liver, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg