rs7274074 chr20:62873761 C>T
- Sequence
aggaaaaaccaggccatacagaga[C/T]aggagctgaggggacatggtgaga
- ASB in cell types
- K562 (myelogenous leukemia) GM18505 (female B-cells Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.20 | 1.04 | 2.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | -0.61 | 3.35 | 1.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | 0.89 | -0.93 | 1.00 |
Items per page:
1 – 3 of 3