rs72763120 chr15:91069174 T>C
- Sequence
caggcagttagagcaacagcctgc[T/C]tttccccagtggagggcgttgttg
- ASB in cell types
- epithelial cell of prostate
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epithelial cell of prostate | -2.34 | 2.29 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Spleen