rs72794541 chr2:42060791 C>T
- Sequence
gtgaggctctggagccagccaaag[C/T]tgggcaggagtcccagacagttct
- ASB in cell types
- breast tumor macrophages form periferal blood MDM(monocyte derived macrophages) monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.18 | -0.17 | 1.73 | n/a | No Hit | |||
| ESR1_HUMAN | 3.12 | -0.40 | 1.67 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung