rs728189 chr12:12008607 C>A
- Sequence
tgttgccagtgcacagggaacaat[C/A]ctcagtgtctgttacacaaatgag
- ASB in cell types
- KMS-11 (Plasma cell myeloma) SK-N-SH (neuroblastoma) MCF10A (breast epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| KMS-11 (Plasma cell myeloma) | 1.89 | 0.34 | 1.50 | |||
| SK-N-SH (neuroblastoma) | 1.90 | 0.48 | 1.25 | |||
| MCF10A (breast epithelial cells) | 0.02 | 2.49 | 1.00 |
Items per page:
1 – 3 of 3