rs72862124 chr2:152861516 C>T
- Sequence
aaagaagttgaaatgtgacacagg[C/T]gccactagctatagtcaacaccag
- ASB in cell types
- THP-1 (acute monocytic leukemia) neural cell esophagus squamous epithelium
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 0.34 | 0.98 | 1.00 | |||
| neural cell | -0.38 | 1.15 | 1.00 | |||
| esophagus squamous epithelium | -1.96 | 2.24 | 1.00 |
Items per page:
1 – 3 of 3