rs72865868 chr6:32969659 C>T
- Sequence
cacggcctgtggggccttttgccc[C/T]tgtagggtctttactgagcacgtg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- SRF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRF_HUMAN | n/a | 4.36 | 1.00 | 1.89 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
