rs72885748 chr2:48205735 G>C
- Sequence
aaagctcaaatctcttgggggtta[G/C]atatgcttcacagggccatggatt
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) GM02630 (Fanconi anemi) GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.61 | -0.19 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1