rs72923105 chr1:2382777 G>A
- Sequence
tgagaacccgcagcaccagcccag[G/A]ccagcaggggcagcaacgacgctg
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | -0.69 | 2.26 | 1.17 | |||
| erythroid progenitors | 3.23 | n/a | 2.00 |
Items per page:
1 – 2 of 2