rs7300021 chr12:22794215 G>C
- Sequence
gagcctcagttgttttttgattgc[G/C]caatggatataataaactttttgg
- ASB in cell types
- SU-DHL-1 (Anaplastic large cell lymphoma)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 2.92 | -4.99 | 1.50 | -6.84 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
