rs7301893 chr12:111331359 C>A
- Sequence
atggttattttaacaagtttccag[C/A]aggtggcagttgaatgcctcaagg
- ASB in cell types
- foreskin keratinocyte ID00014 (lymphoblastoid cell, DiGeorge syndrome) GM19193 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.12 | -1.03 | 2.71 | -2.27 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
