rs73041379 chr2:184598808 G>A
- Sequence
cctcggcgctcaccacagaggggt[G/A]cagtgagccagtctccagaggacg
- ASB in cell types
- GM02630 (Fanconi anemi) GM18486 (Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 2.25 | 1.83 | 1.10 | n/a | n/a |
Items per page:
1 – 1 of 1