rs73051259 chr5:10524739 A>G
- Sequence
tgactgctgcccctccacaatccc[A/G]cctgctcggcccggcatctgctac
- ASB in cell types
- G523NS (glioblastoma)
- ASB for transcription factors
- ASCL1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ASCL1_HUMAN | 3.09 | -3.23 | 1.00 | -5.46 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
