rs7305525 chr12:4758204 T>C
- Sequence
tggtttgtgtgagactatttgcct[T/C]ttaaaacatctaagtacttattag
- ASB in cell types
- thoracic aorta
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| thoracic aorta | 1.80 | -1.50 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, asthma, hip bone mineral density (bmd), hypertension (early onset hypertension), microalbuminuria, paternal transmission distortion, spine bone mineral density (bmd), variant creutzfeldt-jakob disease
GTEx eQTL Adrenal_Gland, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Uterus, Whole_Blood