rs7307375 chr12:92608419 C>T
- Sequence
ttgttactagggcttcctgtgtca[C/T]ggactatatcgacttctttgcttc
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GM19239 (male B-cells lymphoblastoid cell line) GM12878 (female B-cells lymphoblastoid cell line) GM19099 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 2.13 | -0.45 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, cystatin c in serum, hypertension (early onset hypertension), microalbuminuria, neuroblastoma (brain cancer), obesity with early age of onset (age >2), total cholesterol, urinary albumin-to-creatinine ratio