rs7311707 chr12:7933469 C>T
- Sequence
gaggtgaaagagtgggaggaagaa[C/T]agcaccgcccagcgttccgggagt
- ASB in cell types
- HeLa Kyoto (cervical adenocarcinoma) neutrophils from periferal blood HMEC (human mammary epithelial cells)
- ASB for transcription factors
- STAG2_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG2_HUMAN | 2.07 | -1.13 | 1.00 | n/a | n/a | |||
| CTCF_HUMAN | 1.23 | 0.39 | 1.56 | 0.13 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
