rs7312804 chr12:127690424 A>C
- Sequence
taatgtaaatggtaataatataca[A/C]atgagtgagtgcacactgaatagt
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | -4.17 | 2.79 | 1.33 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -1.73 | 2.26 | 1.00 |
Items per page:
1 – 2 of 2