rs731441 chr18:9804044 A>C
- Sequence
ctgccctgagcccgggaggtggcc[A/C]tgctggcagtgagggatgtggcct
- ASB in cell types
- K562 (myelogenous leukemia) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.68 | 0.75 | 1.08 | |||
| 22RV1 (prostate carcinoma) | 2.26 | -0.44 | 2.00 |
Items per page:
1 – 2 of 2