rs7316130 chr12:52217268 G>A
- Sequence
ctcctccttccctgagccttcaag[G/A]cctgatggtaaggtctcggtccca
- ASB in cell types
- 22RV1 (prostate carcinoma) MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 1.98 | 1.23 | 2.00 | |||
| MDM(monocyte derived macrophages) | 1.94 | n/a | 3.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis