rs73218081 chr7:93245770 T>G
- Sequence
gtaggctttaaaagataagtttat[T/G]taaaatgcacacagaaactgatga
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) HMEC (human mammary epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | -0.34 | 1.02 | 1.00 | |||
| HMEC (human mammary epithelial cells) | -1.90 | 2.29 | 1.00 |
Items per page:
1 – 2 of 2