rs73234873 chr7:127651950 C>T
- Sequence
tcctttccttcccactacacctcc[C/T]gacattacctactccggctgcccc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) HepG2 (hepatoblastoma) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ZN143_HUMAN RBM25_HUMAN GABPA_HUMAN NR2C1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN143_HUMAN | 1.56 | -2.47 | 1.75 | -3.42 | Concordant | |||
| RBM25_HUMAN | 1.53 | 4.08 | 1.50 | n/a | n/a | |||
| GABPA_HUMAN | 1.46 | -0.34 | 1.62 | n/a | No Hit | |||
| NR2C1_HUMAN | 1.54 | -1.98 | 1.83 | n/a | No Hit | |||
| THA11_HUMAN | 2.24 | -2.15 | 1.00 | -3.53 | Concordant |
Items per page:
1 – 5 of 16
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Amygdala, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Hippocampus, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid