rs73234874 chr7:127651967 G>A
- Sequence
cacctcccgacattacctactccg[G/A]ctgccccggaagtcccgccccata
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma) HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ZN143_HUMAN GABPA_HUMAN NR2C1_HUMAN RFOX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN143_HUMAN | 1.37 | -2.69 | 1.80 | n/a | No Hit | |||
| GABPA_HUMAN | 1.63 | -0.18 | 1.62 | n/a | No Hit | |||
| NR2C1_HUMAN | 1.65 | -2.13 | 1.83 | n/a | No Hit | |||
| RFOX2_HUMAN | 2.51 | -3.49 | 1.62 | n/a | n/a | |||
| THA11_HUMAN | 2.25 | -1.78 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 12
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Amygdala, Brain_Caudate_basal_ganglia, Brain_Hippocampus, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid