rs73298167 chr12:48796068 G>A
- Sequence
cccatagttagttcccaacttttc[G/A]ctactcaatctatagtcttctctg
- ASB in cell types
- aortic adventitial fibroblasts CUTLL1 (T-cell lymphoblastic lymphoma 1) neutrophils liver
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.85 | -0.02 | 1.30 | n/a | No Hit | |||
| RAD21_HUMAN | 2.08 | 0.17 | 1.08 | n/a | n/a |
Items per page:
1 – 2 of 2