rs733021 chr16:85465284 C>G
- Sequence
ctctcctgccaaccgaatctcatg[C/G]tgcttctgtgccacgccctggccc
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.18 | 0.25 | 1.12 | n/a | No Hit |
Items per page:
1 – 1 of 1