rs733093 chr20:54862483 G>A
- Sequence
tttgatggacatatgaaggattca[G/A]tagtaactgttgattgacagctga
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | n/a | 1.53 | 6.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, birth weight, chronic kidney disease, college completion, infant head circumference, prop taste detection threshold, rheumatoid arthritis, years of education