rs733553 chr12:115867127 C>T
- Sequence
gttgccttaaccagcagatggcag[C/T]gccacattcaacatcatgccatct
- ASB in cell types
- PC9 (lung adenocarcinoma) esophagus squamous epithelium glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | n/a | 2.05 | 2.00 | |||
| esophagus squamous epithelium | -1.69 | 2.04 | 1.00 | |||
| glioblastoma cells | -1.76 | 1.57 | 1.33 |
Items per page:
1 – 3 of 3